Review



p5 plates  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    MedChemExpress p5 plates
    P5 Plates, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p5 plates/product/MedChemExpress
    Average 94 stars, based on 26 article reviews
    p5 plates - by Bioz Stars, 2026-04
    94/100 stars

    Images



    Similar Products

    99
    ATCC sub inhibitory fusidic acid concentrations plain agar plates baseline p1 p2 p3 p4 p5 p6 p7 p8 p9 p10 r1 r2 r3 r4 r5 atcc
    Sub Inhibitory Fusidic Acid Concentrations Plain Agar Plates Baseline P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 R1 R2 R3 R4 R5 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sub inhibitory fusidic acid concentrations plain agar plates baseline p1 p2 p3 p4 p5 p6 p7 p8 p9 p10 r1 r2 r3 r4 r5 atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    sub inhibitory fusidic acid concentrations plain agar plates baseline p1 p2 p3 p4 p5 p6 p7 p8 p9 p10 r1 r2 r3 r4 r5 atcc - by Bioz Stars, 2026-04
    99/100 stars
      Buy from Supplier

    94
    MedChemExpress p5 plates
    P5 Plates, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p5 plates/product/MedChemExpress
    Average 94 stars, based on 1 article reviews
    p5 plates - by Bioz Stars, 2026-04
    94/100 stars
      Buy from Supplier

    90
    Kaneka Corp p5 8bp primer plate (384

    P5 8bp Primer Plate (384, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p5 8bp primer plate (384/product/Kaneka Corp
    Average 90 stars, based on 1 article reviews
    p5 8bp primer plate (384 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    99
    ATCC sub inhibitory sodium bituminosulfonate concentrations plain agar plates baseline p1a p2 p3 p4 p5 p6 p7 p8 p9 p10 r1b r2 r3 r4 r5 atcc

    Sub Inhibitory Sodium Bituminosulfonate Concentrations Plain Agar Plates Baseline P1a P2 P3 P4 P5 P6 P7 P8 P9 P10 R1b R2 R3 R4 R5 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sub inhibitory sodium bituminosulfonate concentrations plain agar plates baseline p1a p2 p3 p4 p5 p6 p7 p8 p9 p10 r1b r2 r3 r4 r5 atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    sub inhibitory sodium bituminosulfonate concentrations plain agar plates baseline p1a p2 p3 p4 p5 p6 p7 p8 p9 p10 r1b r2 r3 r4 r5 atcc - by Bioz Stars, 2026-04
    99/100 stars
      Buy from Supplier

    90
    Illumina Inc plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat

    Plate Adapters P5: Aatgatacggcgaccaccgagatctacac P7: Caagcagaagacggcatacgagat, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat/product/Illumina Inc
    Average 90 stars, based on 1 article reviews
    plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    90
    Protech Technology Enterprise 5-mm diameter platinum plate electrodes cuy650-p5

    5 Mm Diameter Platinum Plate Electrodes Cuy650 P5, supplied by Protech Technology Enterprise, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5-mm diameter platinum plate electrodes cuy650-p5/product/Protech Technology Enterprise
    Average 90 stars, based on 1 article reviews
    5-mm diameter platinum plate electrodes cuy650-p5 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    90
    Schmizo AG suction plates ø borosilicate glass pore size p5

    Suction Plates ø Borosilicate Glass Pore Size P5, supplied by Schmizo AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/suction plates ø borosilicate glass pore size p5/product/Schmizo AG
    Average 90 stars, based on 1 article reviews
    suction plates ø borosilicate glass pore size p5 - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    90
    Alfa Laval spiral plate heat exchanger alfa laval model p5-vrb

    Spiral Plate Heat Exchanger Alfa Laval Model P5 Vrb, supplied by Alfa Laval, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spiral plate heat exchanger alfa laval model p5-vrb/product/Alfa Laval
    Average 90 stars, based on 1 article reviews
    spiral plate heat exchanger alfa laval model p5-vrb - by Bioz Stars, 2026-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Chronological and genetic analysis of an Upper Palaeolithic female infant burial from Borsuka Cave, Poland

    doi: 10.1016/j.isci.2023.108283

    Figure Lengend Snippet:

    Article Snippet: P5 8bp primer plate (384) , Eurogentec , N/A.

    Techniques: Recombinant, Magnetic Beads, Hybridization, Blocking Assay, SYBR Green Assay, Purification, Software, Ancient DNA Assay